Flow Cytometry:Article Title: Generation of circulating autoreactive pre-plasma cells fueled by naive B cells in celiac disease.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Antibodies used for flow cytometry (Table S2) See Table S2 See Table S2 Goat anti-human Ig SouthernBiotech Cat# 2010-01; RRID:AB_2687525 AP-goat anti-human IgM SouthernBiotech Cat# 2020-04; RRID:AB_2795602 AP-goat anti-human IgA Sigma Cat# A9669; RRID:AB_258467 AP-goat anti-human IgG SouthernBiotech Cat# 2040-04; RRID:AB_2795643 Mouse anti-human IL-21 Thermo Cat# 14-7219-81; RRID:AB_1311262 Biotin-mouse anti-human IL-21 Thermo Cat# 13-7218-81; RRID:AB_1272318 Barcoded mouse anti-human CD27, TotalSeq-C0154 BioLegend Cat# 302853; RRID:AB_2800747 Barcoded mouse anti-human hashtag 1, TotalSeq-C0251 BioLegend Cat# 394661; RRID:AB_2801031 Barcoded mouse anti-human hashtag 2, TotalSeq-C0252 BioLegend Cat# 394663; RRID:AB_2801032 Biological samples Blood samples of CeD patients and controls This paper N/A Duodenal biopsies of CeD patients and controls This paper N/A Chemicals, peptides, and recombinant proteins Streptavidin-AP SouthernBiotech Cat# 7105-04 Streptavidin-PE Thermo Cat# S866 Streptavidin-PE/Cy7 Thermo Cat# SA1012 Barcoded streptavidin-PE, TotalSeq-C0951 BioLegend Cat# 405261 FcR Blocking Reagent Miltenyi Cat# 130-059-901 LIVE/DEAD fixable Aqua Thermo Cat# L34957 Lipofectin Thermo Cat# 18292011 Retinoic acid Sigma Cat# R2625 Recombinant human IL-21 R&D Systems Cat# 8879-IL-010 Biotin-TG2 This paper N/A Biotin-GST This paper N/A Recombinant anti-TG2 mAbs Iversen et al. 201565 N/A Tn5 transposase University of Oslo N/A Critical commercial assays BirA biotin-protein ligase reaction kit Avidity Cat# Bulk BirA Anti-PE microbeads Miltenyi Cat# 130-048-801 B cell isolation kit II Miltenyi Cat# 130-091-151 MS columns Miltenyi Cat# 130-042-201 LS columns Miltenyi Cat# 130-042-401 FoxP3/Transcription Factor Staining Buffer Set Thermo Cat# 00-5523-00 MultiScreen plates Sigma Cat# MSIPS4510 RNAClean XP beads Beckman Coulter Cat# A63987 AMPure XP beads Beckman Coulter Cat# A63881 SMARTScribe Reverse Transcriptase Takara Cat# 639538 Chromium Single Cell 50 Library & Gel Bead Kit 10x Genomics Cat# 1000014 Chromium Single Cell 50 Library Construction Kit 10x Genomics Cat# 1000020 Chromium Chip A Single Cell Kit 10x Genomics Cat# 1000009 Chromium i7 Multiplex Kit 10x Genomics Cat# 120262 Chromium i7 Multiplex Kit N, Set A 10x Genomics Cat# 1000084 (Continued on next page) 16 Cell Reports 43, 114045, April 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Chromium Single Cell 50 Feature Barcode Library Kit 10x Genomics Cat# 1000080 Chromium Single Cell V(D)J Enrichment Kit, Human B cells 10x Genomics Cat# 1000016 Deposited data scRNA-seq and V(D)J sequences of circulating B cells This study European Genome-Phenome Archive: EGAS50000000229 scRNA-seq and V(D)J sequences of gut plasma cells This study European Genome-Phenome Archive: EGAS50000000229 V(D)J sequences of single B cell cultures This study European Genome-Phenome Archive: EGAS50000000229 V(D)J sequences of gut plasma cells Lindeman et al. 20213 European Genome-Phenome Archive: EGAS00001004623 Experimental models: Cell lines Transfected NIH/3T3 fibroblasts (clone 2B09) This paper N/A Oligonucleotides IgA primers Zhou et al. 202266 N/A Smart-seq2 primers Picelli et al. 201421 N/A Nextera (XT) N7xx and S5xx index primers Biomers N/A 50-Bio-TSO Qiagen N/A Recombinant DNA AviTag-TG2 in pET28a Hnida et al. 201667 N/A AviTag-GST in pET28a This study N/A Human BAFF in pUNO1 InvivoGen Cat# puno1-htnfsf13b Human CD40L in pUNO1 InvivoGen Cat# puno1-hcd40lg Human IL-21 in pUNO1 InvivoGen Cat# puno1-hil21 Human IL-21 in pcDNA3 This study N/A Software and algorithms FlowJo v10 BD https://www.flowjo.com/ GraphPad Prism v9 Dotmatrics https://www.graphpad.com/ R v3.5.3 and v.4.3.1 The R Foundation https://www.r-project.org ggpubr v0.6.0 N/A https://cran.r-project.org/web/ packages/ggpubr/index.html Python v.3.7 Python Software Foundation https://www.python.org Cell Ranger v6.0.2 10x Genomics https://www.10xgenomics.com/ support/software/cell-ranger/latest Seurat v4.3.0.1 Hao et al. 202168 https://satijalab.org/seurat/ Cutadapt v1.18 Martin 201169 https://cutadapt.readthedocs.io/ en/stable/ Trim Galore v0.6.1 N/A https://www.bioinformatics.babraham. ac.uk/projects/trim_galore/ Salmon v0.11.3 Patro et al. 201770 https://github.com/COMBINE-lab/salmon tximport v1.8.0 Soneson et al. 201571 https://bioconductor.org/packages/ release/bioc/html/tximport.html BraCeR Lindeman et al. 201872 https://github.com/Teichlab/bracer Scater McCarthy et al. 201773 https://bioconductor.org/packages/ release/bioc/html/scater.html Scanpy v1.9.1 Wolf et al. 201874 https://scanpy.readthedocs.io/en/stable/ NaiveDE v1.2.0 N/A https://github.com/Teichlab/NaiveDE scikit-learn v1.0.2 Pedregosa et al. 201175 https://scikit-learn.org/stable/ EnhancedVolcano v1.18.0 N/A https://github.com/kevinblighe/ EnhancedVolcano (Continued on next page) Cell Reports 43, 114045, April 23, 2024 17
Recombinant:Article Title: Generation of circulating autoreactive pre-plasma cells fueled by naive B cells in celiac disease.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Antibodies used for flow cytometry (Table S2) See Table S2 See Table S2 Goat anti-human Ig SouthernBiotech Cat# 2010-01; RRID:AB_2687525 AP-goat anti-human IgM SouthernBiotech Cat# 2020-04; RRID:AB_2795602 AP-goat anti-human IgA Sigma Cat# A9669; RRID:AB_258467 AP-goat anti-human IgG SouthernBiotech Cat# 2040-04; RRID:AB_2795643 Mouse anti-human IL-21 Thermo Cat# 14-7219-81; RRID:AB_1311262 Biotin-mouse anti-human IL-21 Thermo Cat# 13-7218-81; RRID:AB_1272318 Barcoded mouse anti-human CD27, TotalSeq-C0154 BioLegend Cat# 302853; RRID:AB_2800747 Barcoded mouse anti-human hashtag 1, TotalSeq-C0251 BioLegend Cat# 394661; RRID:AB_2801031 Barcoded mouse anti-human hashtag 2, TotalSeq-C0252 BioLegend Cat# 394663; RRID:AB_2801032 Biological samples Blood samples of CeD patients and controls This paper N/A Duodenal biopsies of CeD patients and controls This paper N/A Chemicals, peptides, and recombinant proteins Streptavidin-AP SouthernBiotech Cat# 7105-04 Streptavidin-PE Thermo Cat# S866 Streptavidin-PE/Cy7 Thermo Cat# SA1012 Barcoded streptavidin-PE, TotalSeq-C0951 BioLegend Cat# 405261 FcR Blocking Reagent Miltenyi Cat# 130-059-901 LIVE/DEAD fixable Aqua Thermo Cat# L34957 Lipofectin Thermo Cat# 18292011 Retinoic acid Sigma Cat# R2625 Recombinant human IL-21 R&D Systems Cat# 8879-IL-010 Biotin-TG2 This paper N/A Biotin-GST This paper N/A Recombinant anti-TG2 mAbs Iversen et al. 201565 N/A Tn5 transposase University of Oslo N/A Critical commercial assays BirA biotin-protein ligase reaction kit Avidity Cat# Bulk BirA Anti-PE microbeads Miltenyi Cat# 130-048-801 B cell isolation kit II Miltenyi Cat# 130-091-151 MS columns Miltenyi Cat# 130-042-201 LS columns Miltenyi Cat# 130-042-401 FoxP3/Transcription Factor Staining Buffer Set Thermo Cat# 00-5523-00 MultiScreen plates Sigma Cat# MSIPS4510 RNAClean XP beads Beckman Coulter Cat# A63987 AMPure XP beads Beckman Coulter Cat# A63881 SMARTScribe Reverse Transcriptase Takara Cat# 639538 Chromium Single Cell 50 Library & Gel Bead Kit 10x Genomics Cat# 1000014 Chromium Single Cell 50 Library Construction Kit 10x Genomics Cat# 1000020 Chromium Chip A Single Cell Kit 10x Genomics Cat# 1000009 Chromium i7 Multiplex Kit 10x Genomics Cat# 120262 Chromium i7 Multiplex Kit N, Set A 10x Genomics Cat# 1000084 (Continued on next page) 16 Cell Reports 43, 114045, April 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Chromium Single Cell 50 Feature Barcode Library Kit 10x Genomics Cat# 1000080 Chromium Single Cell V(D)J Enrichment Kit, Human B cells 10x Genomics Cat# 1000016 Deposited data scRNA-seq and V(D)J sequences of circulating B cells This study European Genome-Phenome Archive: EGAS50000000229 scRNA-seq and V(D)J sequences of gut plasma cells This study European Genome-Phenome Archive: EGAS50000000229 V(D)J sequences of single B cell cultures This study European Genome-Phenome Archive: EGAS50000000229 V(D)J sequences of gut plasma cells Lindeman et al. 20213 European Genome-Phenome Archive: EGAS00001004623 Experimental models: Cell lines Transfected NIH/3T3 fibroblasts (clone 2B09) This paper N/A Oligonucleotides IgA primers Zhou et al. 202266 N/A Smart-seq2 primers Picelli et al. 201421 N/A Nextera (XT) N7xx and S5xx index primers Biomers N/A 50-Bio-TSO Qiagen N/A Recombinant DNA AviTag-TG2 in pET28a Hnida et al. 201667 N/A AviTag-GST in pET28a This study N/A Human BAFF in pUNO1 InvivoGen Cat# puno1-htnfsf13b Human CD40L in pUNO1 InvivoGen Cat# puno1-hcd40lg Human IL-21 in pUNO1 InvivoGen Cat# puno1-hil21 Human IL-21 in pcDNA3 This study N/A Software and algorithms FlowJo v10 BD https://www.flowjo.com/ GraphPad Prism v9 Dotmatrics https://www.graphpad.com/ R v3.5.3 and v.4.3.1 The R Foundation https://www.r-project.org ggpubr v0.6.0 N/A https://cran.r-project.org/web/ packages/ggpubr/index.html Python v.3.7 Python Software Foundation https://www.python.org Cell Ranger v6.0.2 10x Genomics https://www.10xgenomics.com/ support/software/cell-ranger/latest Seurat v4.3.0.1 Hao et al. 202168 https://satijalab.org/seurat/ Cutadapt v1.18 Martin 201169 https://cutadapt.readthedocs.io/ en/stable/ Trim Galore v0.6.1 N/A https://www.bioinformatics.babraham. ac.uk/projects/trim_galore/ Salmon v0.11.3 Patro et al. 201770 https://github.com/COMBINE-lab/salmon tximport v1.8.0 Soneson et al. 201571 https://bioconductor.org/packages/ release/bioc/html/tximport.html BraCeR Lindeman et al. 201872 https://github.com/Teichlab/bracer Scater McCarthy et al. 201773 https://bioconductor.org/packages/ release/bioc/html/scater.html Scanpy v1.9.1 Wolf et al. 201874 https://scanpy.readthedocs.io/en/stable/ NaiveDE v1.2.0 N/A https://github.com/Teichlab/NaiveDE scikit-learn v1.0.2 Pedregosa et al. 201175 https://scikit-learn.org/stable/ EnhancedVolcano v1.18.0 N/A https://github.com/kevinblighe/ EnhancedVolcano (Continued on next page) Cell Reports 43, 114045, April 23, 2024 17
Article Title: Distinct systemic and gut IgA responses to bacteria of the human upper gastrointestinal tract.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies FITC-mouse anti-human CD38 Thermo Fisher Cat# 11-0388-42, RRID:AB_10547895 APC-mouse anti-human IgA Miltenyi Cat# 130-113-472, RRID:AB_2733422 PerCP/Cy5.5-mouse anti-human IgD BioLegend Cat# 348208, RRID:AB_10641706 BV510-mouse anti-human CD3 BioLegend Cat# 317331, RRID:AB_2561376 BV510-mouse anti-human CD14 BioLegend Cat# 301842, RRID:AB_2561946 AF647-goat F(ab’)2 anti-human IgA SouthernBiotech Cat# 2052-31, RRID:AB_2795711 Goat anti-human Ig SouthernBiotech Cat# 2010-01, RRID:AB_2687525 AP-goat anti-human IgA Sigma Cat# A9669, RRID:AB_258467 AP-goat anti-human IgG SouthernBiotech Cat# 2040-04, RRID:AB_2795643 AP-goat anti-human IgM SouthernBiotech Cat# 2020-04, RRID:AB_2795602 Rabbit anti-human IgA Agilent Cat# A0262, RRID:AB_3094763 HRP-goat anti-rabbit Ig SouthernBiotech Cat# 4010-05, RRID:AB_2632593 Barcoded mouse anti-human CD27, TotalSeq-C0154 BioLegend Cat# 302853, RRID:AB_2800747 Barcoded mouse anti-human hashtag 1, TotalSeq-C0251 BioLegend Cat# 394661, RRID:AB_2801031 Barcoded mouse anti-human hashtag 2, TotalSeq-C0252 BioLegend Cat# 394663, RRID:AB_2801032 Biological samples Blood samples of patients with celiac disease and controls This paper N/A Duodenal biopsies This paper N/A Bone marrow aspirates This paper N/A Chemicals, peptides, and recombinant proteins Streptavidin-PE Thermo Fisher Cat# S866 Streptavidin-PE/Cy7 Thermo Fisher Cat# SA1012 Barcoded streptavidin-PE, TotalSeq-C0951 BioLegend Cat# 405261 FcR Blocking Reagent Miltenyi Cat# 130-059-901 LIVE/DEAD fixable Aqua Thermo Fisher Cat# L34957 LIVE/DEAD fixable Near-IR Thermo Fisher Cat# L10119 4% formaldehyde fixative solution Thermo Fisher Cat# FB002 Calf thymus DNA Thermo Fisher Cat# 15633019 Keyhole limpet hemocyanin Sigma Cat# H8283 Human insulin Sigma Cat# I9278 LPS from E. coli O55:B5 Sigma Cat# L2637 LPS from E. coli O111:B4 Sigma Cat# L3012 LPS from K. pneumoniae Sigma Cat# L4268 Ultrapure LPS from E. coli O55:B5 InvivoGen Cat# tlrl-pb5lps Recombinant Lpp from E. coli TargetMol Cat# TMPH-00651 Mutanolysin Sigma Cat# M9901 Proteinase K Qiagen Cat# 69504 Biotin-TG2 Lindeman et al.29 N/A Biotin-GST Lindeman et al.29 N/A (Continued on next page) 16 Cell Reports 45, 117721, August 25, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant anti-TG2 IgA1 mAb Iversen et al.89 N/A Recombinant polyreactive IgG1 mAb Das et al.90 N/A Recombinant IgA1 mAbs cloned from human plasma cells This paper N/A Critical commercial assays AnaeroGen sachets Thermo Fisher Cat# AN0025A Peptide M-agarose InvivoGen Cat# gel-pdm-2 HiTrap protein G columns Cytiva Cat# 29048581 MultiScreen 96 well plates Sigma Cat# MSIPS4510 4-20% Tris-glycine gels Thermo Fisher Cat# XP04200BOX West Pico PLUS substrate Thermo Fisher Cat# 34580 BCIP/NBT substrate Bio-Rad Cat# 1706432 PageBlue protein staining solution Thermo Fisher Cat# 24620 Chromium Single Cell 5′ Library & Gel Bead Kit 10x Genomics Cat# 1000014 Chromium Single Cell 5′ Library Construction Kit 10x Genomics Cat# 1000020 Chromium Chip A Single Cell Kit 10x Genomics Cat# 1000009 Chromium i7 Multiplex Kit 10x Genomics Cat# 120262 Chromium i7 Multiplex Kit N, Set A 10x Genomics Cat# 1000084 Chromium Single Cell 5′ Feature Barcode Library Kit 10x Genomics Cat# 1000080 Chromium Single Cell V(D)J Enrichment Kit, Human B cells 10x Genomics Cat# 1000016 Deposited data scRNA-seq and V(D)J sequences of gut and BM plasma cells This study Federated European Genome-Phenome Archive: EGAS50000001912 Experimental models: strains Bacterial isolates from duodenal biopsies This paper N/A Control strains See Table S3 See Table S3 Oligonucleotides Immunoglobulin primers Tiller et al.88 N/A BlpI-IGHA reverse primer CAGAGGCTCAGCGGGAAGACCTTG Eurogentec N/A Recombinant DNA Heavy chain V regions in AbVec-hIgA1 This study N/A Kappa light chain V regions in AbVechIgKappa This study N/A Lambda light chain V regions in AbVechIgLambda This study N/A Software and algorithms FlowJo v10 BD https://www.flowjo.com/ GraphPad Prism v10 Dotmatrics https://www.graphpad.com/ R v.4.4.3 The R Foundation https://www.r-project.org ggpubr v0.6.0 N/A https://cran.r-project.org/web/packages/ ggpubr/index.html Cell Ranger v6.0.2 10x Genomics https://www.10xgenomics.com/support/ software/cell-ranger/latest Seurat v5.2.1 Hao et al. 2021 https://satijalab.org/seurat/ EnhancedVolcano v1.18.0 N/A https://github.com/kevinblighe/ EnhancedVolcano (Continued on next page) Cell Reports 45, 117721, August 25, 2026 17
Blocking Assay:Article Title: Generation of circulating autoreactive pre-plasma cells fueled by naive B cells in celiac disease.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Antibodies used for flow cytometry (Table S2) See Table S2 See Table S2 Goat anti-human Ig SouthernBiotech Cat# 2010-01; RRID:AB_2687525 AP-goat anti-human IgM SouthernBiotech Cat# 2020-04; RRID:AB_2795602 AP-goat anti-human IgA Sigma Cat# A9669; RRID:AB_258467 AP-goat anti-human IgG SouthernBiotech Cat# 2040-04; RRID:AB_2795643 Mouse anti-human IL-21 Thermo Cat# 14-7219-81; RRID:AB_1311262 Biotin-mouse anti-human IL-21 Thermo Cat# 13-7218-81; RRID:AB_1272318 Barcoded mouse anti-human CD27, TotalSeq-C0154 BioLegend Cat# 302853; RRID:AB_2800747 Barcoded mouse anti-human hashtag 1, TotalSeq-C0251 BioLegend Cat# 394661; RRID:AB_2801031 Barcoded mouse anti-human hashtag 2, TotalSeq-C0252 BioLegend Cat# 394663; RRID:AB_2801032 Biological samples Blood samples of CeD patients and controls This paper N/A Duodenal biopsies of CeD patients and controls This paper N/A Chemicals, peptides, and recombinant proteins Streptavidin-AP SouthernBiotech Cat# 7105-04 Streptavidin-PE Thermo Cat# S866 Streptavidin-PE/Cy7 Thermo Cat# SA1012 Barcoded streptavidin-PE, TotalSeq-C0951 BioLegend Cat# 405261 FcR Blocking Reagent Miltenyi Cat# 130-059-901 LIVE/DEAD fixable Aqua Thermo Cat# L34957 Lipofectin Thermo Cat# 18292011 Retinoic acid Sigma Cat# R2625 Recombinant human IL-21 R&D Systems Cat# 8879-IL-010 Biotin-TG2 This paper N/A Biotin-GST This paper N/A Recombinant anti-TG2 mAbs Iversen et al. 201565 N/A Tn5 transposase University of Oslo N/A Critical commercial assays BirA biotin-protein ligase reaction kit Avidity Cat# Bulk BirA Anti-PE microbeads Miltenyi Cat# 130-048-801 B cell isolation kit II Miltenyi Cat# 130-091-151 MS columns Miltenyi Cat# 130-042-201 LS columns Miltenyi Cat# 130-042-401 FoxP3/Transcription Factor Staining Buffer Set Thermo Cat# 00-5523-00 MultiScreen plates Sigma Cat# MSIPS4510 RNAClean XP beads Beckman Coulter Cat# A63987 AMPure XP beads Beckman Coulter Cat# A63881 SMARTScribe Reverse Transcriptase Takara Cat# 639538 Chromium Single Cell 50 Library & Gel Bead Kit 10x Genomics Cat# 1000014 Chromium Single Cell 50 Library Construction Kit 10x Genomics Cat# 1000020 Chromium Chip A Single Cell Kit 10x Genomics Cat# 1000009 Chromium i7 Multiplex Kit 10x Genomics Cat# 120262 Chromium i7 Multiplex Kit N, Set A 10x Genomics Cat# 1000084 (Continued on next page) 16 Cell Reports 43, 114045, April 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Chromium Single Cell 50 Feature Barcode Library Kit 10x Genomics Cat# 1000080 Chromium Single Cell V(D)J Enrichment Kit, Human B cells 10x Genomics Cat# 1000016 Deposited data scRNA-seq and V(D)J sequences of circulating B cells This study European Genome-Phenome Archive: EGAS50000000229 scRNA-seq and V(D)J sequences of gut plasma cells This study European Genome-Phenome Archive: EGAS50000000229 V(D)J sequences of single B cell cultures This study European Genome-Phenome Archive: EGAS50000000229 V(D)J sequences of gut plasma cells Lindeman et al. 20213 European Genome-Phenome Archive: EGAS00001004623 Experimental models: Cell lines Transfected NIH/3T3 fibroblasts (clone 2B09) This paper N/A Oligonucleotides IgA primers Zhou et al. 202266 N/A Smart-seq2 primers Picelli et al. 201421 N/A Nextera (XT) N7xx and S5xx index primers Biomers N/A 50-Bio-TSO Qiagen N/A Recombinant DNA AviTag-TG2 in pET28a Hnida et al. 201667 N/A AviTag-GST in pET28a This study N/A Human BAFF in pUNO1 InvivoGen Cat# puno1-htnfsf13b Human CD40L in pUNO1 InvivoGen Cat# puno1-hcd40lg Human IL-21 in pUNO1 InvivoGen Cat# puno1-hil21 Human IL-21 in pcDNA3 This study N/A Software and algorithms FlowJo v10 BD https://www.flowjo.com/ GraphPad Prism v9 Dotmatrics https://www.graphpad.com/ R v3.5.3 and v.4.3.1 The R Foundation https://www.r-project.org ggpubr v0.6.0 N/A https://cran.r-project.org/web/ packages/ggpubr/index.html Python v.3.7 Python Software Foundation https://www.python.org Cell Ranger v6.0.2 10x Genomics https://www.10xgenomics.com/ support/software/cell-ranger/latest Seurat v4.3.0.1 Hao et al. 202168 https://satijalab.org/seurat/ Cutadapt v1.18 Martin 201169 https://cutadapt.readthedocs.io/ en/stable/ Trim Galore v0.6.1 N/A https://www.bioinformatics.babraham. ac.uk/projects/trim_galore/ Salmon v0.11.3 Patro et al. 201770 https://github.com/COMBINE-lab/salmon tximport v1.8.0 Soneson et al. 201571 https://bioconductor.org/packages/ release/bioc/html/tximport.html BraCeR Lindeman et al. 201872 https://github.com/Teichlab/bracer Scater McCarthy et al. 201773 https://bioconductor.org/packages/ release/bioc/html/scater.html Scanpy v1.9.1 Wolf et al. 201874 https://scanpy.readthedocs.io/en/stable/ NaiveDE v1.2.0 N/A https://github.com/Teichlab/NaiveDE scikit-learn v1.0.2 Pedregosa et al. 201175 https://scikit-learn.org/stable/ EnhancedVolcano v1.18.0 N/A https://github.com/kevinblighe/ EnhancedVolcano (Continued on next page) Cell Reports 43, 114045, April 23, 2024 17
Article Title: Distinct systemic and gut IgA responses to bacteria of the human upper gastrointestinal tract.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies FITC-mouse anti-human CD38 Thermo Fisher Cat# 11-0388-42, RRID:AB_10547895 APC-mouse anti-human IgA Miltenyi Cat# 130-113-472, RRID:AB_2733422 PerCP/Cy5.5-mouse anti-human IgD BioLegend Cat# 348208, RRID:AB_10641706 BV510-mouse anti-human CD3 BioLegend Cat# 317331, RRID:AB_2561376 BV510-mouse anti-human CD14 BioLegend Cat# 301842, RRID:AB_2561946 AF647-goat F(ab’)2 anti-human IgA SouthernBiotech Cat# 2052-31, RRID:AB_2795711 Goat anti-human Ig SouthernBiotech Cat# 2010-01, RRID:AB_2687525 AP-goat anti-human IgA Sigma Cat# A9669, RRID:AB_258467 AP-goat anti-human IgG SouthernBiotech Cat# 2040-04, RRID:AB_2795643 AP-goat anti-human IgM SouthernBiotech Cat# 2020-04, RRID:AB_2795602 Rabbit anti-human IgA Agilent Cat# A0262, RRID:AB_3094763 HRP-goat anti-rabbit Ig SouthernBiotech Cat# 4010-05, RRID:AB_2632593 Barcoded mouse anti-human CD27, TotalSeq-C0154 BioLegend Cat# 302853, RRID:AB_2800747 Barcoded mouse anti-human hashtag 1, TotalSeq-C0251 BioLegend Cat# 394661, RRID:AB_2801031 Barcoded mouse anti-human hashtag 2, TotalSeq-C0252 BioLegend Cat# 394663, RRID:AB_2801032 Biological samples Blood samples of patients with celiac disease and controls This paper N/A Duodenal biopsies This paper N/A Bone marrow aspirates This paper N/A Chemicals, peptides, and recombinant proteins Streptavidin-PE Thermo Fisher Cat# S866 Streptavidin-PE/Cy7 Thermo Fisher Cat# SA1012 Barcoded streptavidin-PE, TotalSeq-C0951 BioLegend Cat# 405261 FcR Blocking Reagent Miltenyi Cat# 130-059-901 LIVE/DEAD fixable Aqua Thermo Fisher Cat# L34957 LIVE/DEAD fixable Near-IR Thermo Fisher Cat# L10119 4% formaldehyde fixative solution Thermo Fisher Cat# FB002 Calf thymus DNA Thermo Fisher Cat# 15633019 Keyhole limpet hemocyanin Sigma Cat# H8283 Human insulin Sigma Cat# I9278 LPS from E. coli O55:B5 Sigma Cat# L2637 LPS from E. coli O111:B4 Sigma Cat# L3012 LPS from K. pneumoniae Sigma Cat# L4268 Ultrapure LPS from E. coli O55:B5 InvivoGen Cat# tlrl-pb5lps Recombinant Lpp from E. coli TargetMol Cat# TMPH-00651 Mutanolysin Sigma Cat# M9901 Proteinase K Qiagen Cat# 69504 Biotin-TG2 Lindeman et al.29 N/A Biotin-GST Lindeman et al.29 N/A (Continued on next page) 16 Cell Reports 45, 117721, August 25, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant anti-TG2 IgA1 mAb Iversen et al.89 N/A Recombinant polyreactive IgG1 mAb Das et al.90 N/A Recombinant IgA1 mAbs cloned from human plasma cells This paper N/A Critical commercial assays AnaeroGen sachets Thermo Fisher Cat# AN0025A Peptide M-agarose InvivoGen Cat# gel-pdm-2 HiTrap protein G columns Cytiva Cat# 29048581 MultiScreen 96 well plates Sigma Cat# MSIPS4510 4-20% Tris-glycine gels Thermo Fisher Cat# XP04200BOX West Pico PLUS substrate Thermo Fisher Cat# 34580 BCIP/NBT substrate Bio-Rad Cat# 1706432 PageBlue protein staining solution Thermo Fisher Cat# 24620 Chromium Single Cell 5′ Library & Gel Bead Kit 10x Genomics Cat# 1000014 Chromium Single Cell 5′ Library Construction Kit 10x Genomics Cat# 1000020 Chromium Chip A Single Cell Kit 10x Genomics Cat# 1000009 Chromium i7 Multiplex Kit 10x Genomics Cat# 120262 Chromium i7 Multiplex Kit N, Set A 10x Genomics Cat# 1000084 Chromium Single Cell 5′ Feature Barcode Library Kit 10x Genomics Cat# 1000080 Chromium Single Cell V(D)J Enrichment Kit, Human B cells 10x Genomics Cat# 1000016 Deposited data scRNA-seq and V(D)J sequences of gut and BM plasma cells This study Federated European Genome-Phenome Archive: EGAS50000001912 Experimental models: strains Bacterial isolates from duodenal biopsies This paper N/A Control strains See Table S3 See Table S3 Oligonucleotides Immunoglobulin primers Tiller et al.88 N/A BlpI-IGHA reverse primer CAGAGGCTCAGCGGGAAGACCTTG Eurogentec N/A Recombinant DNA Heavy chain V regions in AbVec-hIgA1 This study N/A Kappa light chain V regions in AbVechIgKappa This study N/A Lambda light chain V regions in AbVechIgLambda This study N/A Software and algorithms FlowJo v10 BD https://www.flowjo.com/ GraphPad Prism v10 Dotmatrics https://www.graphpad.com/ R v.4.4.3 The R Foundation https://www.r-project.org ggpubr v0.6.0 N/A https://cran.r-project.org/web/packages/ ggpubr/index.html Cell Ranger v6.0.2 10x Genomics https://www.10xgenomics.com/support/ software/cell-ranger/latest Seurat v5.2.1 Hao et al. 2021 https://satijalab.org/seurat/ EnhancedVolcano v1.18.0 N/A https://github.com/kevinblighe/ EnhancedVolcano (Continued on next page) Cell Reports 45, 117721, August 25, 2026 17
Cell Isolation:Article Title: Generation of circulating autoreactive pre-plasma cells fueled by naive B cells in celiac disease.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Antibodies used for flow cytometry (Table S2) See Table S2 See Table S2 Goat anti-human Ig SouthernBiotech Cat# 2010-01; RRID:AB_2687525 AP-goat anti-human IgM SouthernBiotech Cat# 2020-04; RRID:AB_2795602 AP-goat anti-human IgA Sigma Cat# A9669; RRID:AB_258467 AP-goat anti-human IgG SouthernBiotech Cat# 2040-04; RRID:AB_2795643 Mouse anti-human IL-21 Thermo Cat# 14-7219-81; RRID:AB_1311262 Biotin-mouse anti-human IL-21 Thermo Cat# 13-7218-81; RRID:AB_1272318 Barcoded mouse anti-human CD27, TotalSeq-C0154 BioLegend Cat# 302853; RRID:AB_2800747 Barcoded mouse anti-human hashtag 1, TotalSeq-C0251 BioLegend Cat# 394661; RRID:AB_2801031 Barcoded mouse anti-human hashtag 2, TotalSeq-C0252 BioLegend Cat# 394663; RRID:AB_2801032 Biological samples Blood samples of CeD patients and controls This paper N/A Duodenal biopsies of CeD patients and controls This paper N/A Chemicals, peptides, and recombinant proteins Streptavidin-AP SouthernBiotech Cat# 7105-04 Streptavidin-PE Thermo Cat# S866 Streptavidin-PE/Cy7 Thermo Cat# SA1012 Barcoded streptavidin-PE, TotalSeq-C0951 BioLegend Cat# 405261 FcR Blocking Reagent Miltenyi Cat# 130-059-901 LIVE/DEAD fixable Aqua Thermo Cat# L34957 Lipofectin Thermo Cat# 18292011 Retinoic acid Sigma Cat# R2625 Recombinant human IL-21 R&D Systems Cat# 8879-IL-010 Biotin-TG2 This paper N/A Biotin-GST This paper N/A Recombinant anti-TG2 mAbs Iversen et al. 201565 N/A Tn5 transposase University of Oslo N/A Critical commercial assays BirA biotin-protein ligase reaction kit Avidity Cat# Bulk BirA Anti-PE microbeads Miltenyi Cat# 130-048-801 B cell isolation kit II Miltenyi Cat# 130-091-151 MS columns Miltenyi Cat# 130-042-201 LS columns Miltenyi Cat# 130-042-401 FoxP3/Transcription Factor Staining Buffer Set Thermo Cat# 00-5523-00 MultiScreen plates Sigma Cat# MSIPS4510 RNAClean XP beads Beckman Coulter Cat# A63987 AMPure XP beads Beckman Coulter Cat# A63881 SMARTScribe Reverse Transcriptase Takara Cat# 639538 Chromium Single Cell 50 Library & Gel Bead Kit 10x Genomics Cat# 1000014 Chromium Single Cell 50 Library Construction Kit 10x Genomics Cat# 1000020 Chromium Chip A Single Cell Kit 10x Genomics Cat# 1000009 Chromium i7 Multiplex Kit 10x Genomics Cat# 120262 Chromium i7 Multiplex Kit N, Set A 10x Genomics Cat# 1000084 (Continued on next page) 16 Cell Reports 43, 114045, April 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Chromium Single Cell 50 Feature Barcode Library Kit 10x Genomics Cat# 1000080 Chromium Single Cell V(D)J Enrichment Kit, Human B cells 10x Genomics Cat# 1000016 Deposited data scRNA-seq and V(D)J sequences of circulating B cells This study European Genome-Phenome Archive: EGAS50000000229 scRNA-seq and V(D)J sequences of gut plasma cells This study European Genome-Phenome Archive: EGAS50000000229 V(D)J sequences of single B cell cultures This study European Genome-Phenome Archive: EGAS50000000229 V(D)J sequences of gut plasma cells Lindeman et al. 20213 European Genome-Phenome Archive: EGAS00001004623 Experimental models: Cell lines Transfected NIH/3T3 fibroblasts (clone 2B09) This paper N/A Oligonucleotides IgA primers Zhou et al. 202266 N/A Smart-seq2 primers Picelli et al. 201421 N/A Nextera (XT) N7xx and S5xx index primers Biomers N/A 50-Bio-TSO Qiagen N/A Recombinant DNA AviTag-TG2 in pET28a Hnida et al. 201667 N/A AviTag-GST in pET28a This study N/A Human BAFF in pUNO1 InvivoGen Cat# puno1-htnfsf13b Human CD40L in pUNO1 InvivoGen Cat# puno1-hcd40lg Human IL-21 in pUNO1 InvivoGen Cat# puno1-hil21 Human IL-21 in pcDNA3 This study N/A Software and algorithms FlowJo v10 BD https://www.flowjo.com/ GraphPad Prism v9 Dotmatrics https://www.graphpad.com/ R v3.5.3 and v.4.3.1 The R Foundation https://www.r-project.org ggpubr v0.6.0 N/A https://cran.r-project.org/web/ packages/ggpubr/index.html Python v.3.7 Python Software Foundation https://www.python.org Cell Ranger v6.0.2 10x Genomics https://www.10xgenomics.com/ support/software/cell-ranger/latest Seurat v4.3.0.1 Hao et al. 202168 https://satijalab.org/seurat/ Cutadapt v1.18 Martin 201169 https://cutadapt.readthedocs.io/ en/stable/ Trim Galore v0.6.1 N/A https://www.bioinformatics.babraham. ac.uk/projects/trim_galore/ Salmon v0.11.3 Patro et al. 201770 https://github.com/COMBINE-lab/salmon tximport v1.8.0 Soneson et al. 201571 https://bioconductor.org/packages/ release/bioc/html/tximport.html BraCeR Lindeman et al. 201872 https://github.com/Teichlab/bracer Scater McCarthy et al. 201773 https://bioconductor.org/packages/ release/bioc/html/scater.html Scanpy v1.9.1 Wolf et al. 201874 https://scanpy.readthedocs.io/en/stable/ NaiveDE v1.2.0 N/A https://github.com/Teichlab/NaiveDE scikit-learn v1.0.2 Pedregosa et al. 201175 https://scikit-learn.org/stable/ EnhancedVolcano v1.18.0 N/A https://github.com/kevinblighe/ EnhancedVolcano (Continued on next page) Cell Reports 43, 114045, April 23, 2024 17
Staining:Article Title: Generation of circulating autoreactive pre-plasma cells fueled by naive B cells in celiac disease.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Antibodies used for flow cytometry (Table S2) See Table S2 See Table S2 Goat anti-human Ig SouthernBiotech Cat# 2010-01; RRID:AB_2687525 AP-goat anti-human IgM SouthernBiotech Cat# 2020-04; RRID:AB_2795602 AP-goat anti-human IgA Sigma Cat# A9669; RRID:AB_258467 AP-goat anti-human IgG SouthernBiotech Cat# 2040-04; RRID:AB_2795643 Mouse anti-human IL-21 Thermo Cat# 14-7219-81; RRID:AB_1311262 Biotin-mouse anti-human IL-21 Thermo Cat# 13-7218-81; RRID:AB_1272318 Barcoded mouse anti-human CD27, TotalSeq-C0154 BioLegend Cat# 302853; RRID:AB_2800747 Barcoded mouse anti-human hashtag 1, TotalSeq-C0251 BioLegend Cat# 394661; RRID:AB_2801031 Barcoded mouse anti-human hashtag 2, TotalSeq-C0252 BioLegend Cat# 394663; RRID:AB_2801032 Biological samples Blood samples of CeD patients and controls This paper N/A Duodenal biopsies of CeD patients and controls This paper N/A Chemicals, peptides, and recombinant proteins Streptavidin-AP SouthernBiotech Cat# 7105-04 Streptavidin-PE Thermo Cat# S866 Streptavidin-PE/Cy7 Thermo Cat# SA1012 Barcoded streptavidin-PE, TotalSeq-C0951 BioLegend Cat# 405261 FcR Blocking Reagent Miltenyi Cat# 130-059-901 LIVE/DEAD fixable Aqua Thermo Cat# L34957 Lipofectin Thermo Cat# 18292011 Retinoic acid Sigma Cat# R2625 Recombinant human IL-21 R&D Systems Cat# 8879-IL-010 Biotin-TG2 This paper N/A Biotin-GST This paper N/A Recombinant anti-TG2 mAbs Iversen et al. 201565 N/A Tn5 transposase University of Oslo N/A Critical commercial assays BirA biotin-protein ligase reaction kit Avidity Cat# Bulk BirA Anti-PE microbeads Miltenyi Cat# 130-048-801 B cell isolation kit II Miltenyi Cat# 130-091-151 MS columns Miltenyi Cat# 130-042-201 LS columns Miltenyi Cat# 130-042-401 FoxP3/Transcription Factor Staining Buffer Set Thermo Cat# 00-5523-00 MultiScreen plates Sigma Cat# MSIPS4510 RNAClean XP beads Beckman Coulter Cat# A63987 AMPure XP beads Beckman Coulter Cat# A63881 SMARTScribe Reverse Transcriptase Takara Cat# 639538 Chromium Single Cell 50 Library & Gel Bead Kit 10x Genomics Cat# 1000014 Chromium Single Cell 50 Library Construction Kit 10x Genomics Cat# 1000020 Chromium Chip A Single Cell Kit 10x Genomics Cat# 1000009 Chromium i7 Multiplex Kit 10x Genomics Cat# 120262 Chromium i7 Multiplex Kit N, Set A 10x Genomics Cat# 1000084 (Continued on next page) 16 Cell Reports 43, 114045, April 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Chromium Single Cell 50 Feature Barcode Library Kit 10x Genomics Cat# 1000080 Chromium Single Cell V(D)J Enrichment Kit, Human B cells 10x Genomics Cat# 1000016 Deposited data scRNA-seq and V(D)J sequences of circulating B cells This study European Genome-Phenome Archive: EGAS50000000229 scRNA-seq and V(D)J sequences of gut plasma cells This study European Genome-Phenome Archive: EGAS50000000229 V(D)J sequences of single B cell cultures This study European Genome-Phenome Archive: EGAS50000000229 V(D)J sequences of gut plasma cells Lindeman et al. 20213 European Genome-Phenome Archive: EGAS00001004623 Experimental models: Cell lines Transfected NIH/3T3 fibroblasts (clone 2B09) This paper N/A Oligonucleotides IgA primers Zhou et al. 202266 N/A Smart-seq2 primers Picelli et al. 201421 N/A Nextera (XT) N7xx and S5xx index primers Biomers N/A 50-Bio-TSO Qiagen N/A Recombinant DNA AviTag-TG2 in pET28a Hnida et al. 201667 N/A AviTag-GST in pET28a This study N/A Human BAFF in pUNO1 InvivoGen Cat# puno1-htnfsf13b Human CD40L in pUNO1 InvivoGen Cat# puno1-hcd40lg Human IL-21 in pUNO1 InvivoGen Cat# puno1-hil21 Human IL-21 in pcDNA3 This study N/A Software and algorithms FlowJo v10 BD https://www.flowjo.com/ GraphPad Prism v9 Dotmatrics https://www.graphpad.com/ R v3.5.3 and v.4.3.1 The R Foundation https://www.r-project.org ggpubr v0.6.0 N/A https://cran.r-project.org/web/ packages/ggpubr/index.html Python v.3.7 Python Software Foundation https://www.python.org Cell Ranger v6.0.2 10x Genomics https://www.10xgenomics.com/ support/software/cell-ranger/latest Seurat v4.3.0.1 Hao et al. 202168 https://satijalab.org/seurat/ Cutadapt v1.18 Martin 201169 https://cutadapt.readthedocs.io/ en/stable/ Trim Galore v0.6.1 N/A https://www.bioinformatics.babraham. ac.uk/projects/trim_galore/ Salmon v0.11.3 Patro et al. 201770 https://github.com/COMBINE-lab/salmon tximport v1.8.0 Soneson et al. 201571 https://bioconductor.org/packages/ release/bioc/html/tximport.html BraCeR Lindeman et al. 201872 https://github.com/Teichlab/bracer Scater McCarthy et al. 201773 https://bioconductor.org/packages/ release/bioc/html/scater.html Scanpy v1.9.1 Wolf et al. 201874 https://scanpy.readthedocs.io/en/stable/ NaiveDE v1.2.0 N/A https://github.com/Teichlab/NaiveDE scikit-learn v1.0.2 Pedregosa et al. 201175 https://scikit-learn.org/stable/ EnhancedVolcano v1.18.0 N/A https://github.com/kevinblighe/ EnhancedVolcano (Continued on next page) Cell Reports 43, 114045, April 23, 2024 17
Reverse Transcription:Article Title: Generation of circulating autoreactive pre-plasma cells fueled by naive B cells in celiac disease.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Antibodies used for flow cytometry (Table S2) See Table S2 See Table S2 Goat anti-human Ig SouthernBiotech Cat# 2010-01; RRID:AB_2687525 AP-goat anti-human IgM SouthernBiotech Cat# 2020-04; RRID:AB_2795602 AP-goat anti-human IgA Sigma Cat# A9669; RRID:AB_258467 AP-goat anti-human IgG SouthernBiotech Cat# 2040-04; RRID:AB_2795643 Mouse anti-human IL-21 Thermo Cat# 14-7219-81; RRID:AB_1311262 Biotin-mouse anti-human IL-21 Thermo Cat# 13-7218-81; RRID:AB_1272318 Barcoded mouse anti-human CD27, TotalSeq-C0154 BioLegend Cat# 302853; RRID:AB_2800747 Barcoded mouse anti-human hashtag 1, TotalSeq-C0251 BioLegend Cat# 394661; RRID:AB_2801031 Barcoded mouse anti-human hashtag 2, TotalSeq-C0252 BioLegend Cat# 394663; RRID:AB_2801032 Biological samples Blood samples of CeD patients and controls This paper N/A Duodenal biopsies of CeD patients and controls This paper N/A Chemicals, peptides, and recombinant proteins Streptavidin-AP SouthernBiotech Cat# 7105-04 Streptavidin-PE Thermo Cat# S866 Streptavidin-PE/Cy7 Thermo Cat# SA1012 Barcoded streptavidin-PE, TotalSeq-C0951 BioLegend Cat# 405261 FcR Blocking Reagent Miltenyi Cat# 130-059-901 LIVE/DEAD fixable Aqua Thermo Cat# L34957 Lipofectin Thermo Cat# 18292011 Retinoic acid Sigma Cat# R2625 Recombinant human IL-21 R&D Systems Cat# 8879-IL-010 Biotin-TG2 This paper N/A Biotin-GST This paper N/A Recombinant anti-TG2 mAbs Iversen et al. 201565 N/A Tn5 transposase University of Oslo N/A Critical commercial assays BirA biotin-protein ligase reaction kit Avidity Cat# Bulk BirA Anti-PE microbeads Miltenyi Cat# 130-048-801 B cell isolation kit II Miltenyi Cat# 130-091-151 MS columns Miltenyi Cat# 130-042-201 LS columns Miltenyi Cat# 130-042-401 FoxP3/Transcription Factor Staining Buffer Set Thermo Cat# 00-5523-00 MultiScreen plates Sigma Cat# MSIPS4510 RNAClean XP beads Beckman Coulter Cat# A63987 AMPure XP beads Beckman Coulter Cat# A63881 SMARTScribe Reverse Transcriptase Takara Cat# 639538 Chromium Single Cell 50 Library & Gel Bead Kit 10x Genomics Cat# 1000014 Chromium Single Cell 50 Library Construction Kit 10x Genomics Cat# 1000020 Chromium Chip A Single Cell Kit 10x Genomics Cat# 1000009 Chromium i7 Multiplex Kit 10x Genomics Cat# 120262 Chromium i7 Multiplex Kit N, Set A 10x Genomics Cat# 1000084 (Continued on next page) 16 Cell Reports 43, 114045, April 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Chromium Single Cell 50 Feature Barcode Library Kit 10x Genomics Cat# 1000080 Chromium Single Cell V(D)J Enrichment Kit, Human B cells 10x Genomics Cat# 1000016 Deposited data scRNA-seq and V(D)J sequences of circulating B cells This study European Genome-Phenome Archive: EGAS50000000229 scRNA-seq and V(D)J sequences of gut plasma cells This study European Genome-Phenome Archive: EGAS50000000229 V(D)J sequences of single B cell cultures This study European Genome-Phenome Archive: EGAS50000000229 V(D)J sequences of gut plasma cells Lindeman et al. 20213 European Genome-Phenome Archive: EGAS00001004623 Experimental models: Cell lines Transfected NIH/3T3 fibroblasts (clone 2B09) This paper N/A Oligonucleotides IgA primers Zhou et al. 202266 N/A Smart-seq2 primers Picelli et al. 201421 N/A Nextera (XT) N7xx and S5xx index primers Biomers N/A 50-Bio-TSO Qiagen N/A Recombinant DNA AviTag-TG2 in pET28a Hnida et al. 201667 N/A AviTag-GST in pET28a This study N/A Human BAFF in pUNO1 InvivoGen Cat# puno1-htnfsf13b Human CD40L in pUNO1 InvivoGen Cat# puno1-hcd40lg Human IL-21 in pUNO1 InvivoGen Cat# puno1-hil21 Human IL-21 in pcDNA3 This study N/A Software and algorithms FlowJo v10 BD https://www.flowjo.com/ GraphPad Prism v9 Dotmatrics https://www.graphpad.com/ R v3.5.3 and v.4.3.1 The R Foundation https://www.r-project.org ggpubr v0.6.0 N/A https://cran.r-project.org/web/ packages/ggpubr/index.html Python v.3.7 Python Software Foundation https://www.python.org Cell Ranger v6.0.2 10x Genomics https://www.10xgenomics.com/ support/software/cell-ranger/latest Seurat v4.3.0.1 Hao et al. 202168 https://satijalab.org/seurat/ Cutadapt v1.18 Martin 201169 https://cutadapt.readthedocs.io/ en/stable/ Trim Galore v0.6.1 N/A https://www.bioinformatics.babraham. ac.uk/projects/trim_galore/ Salmon v0.11.3 Patro et al. 201770 https://github.com/COMBINE-lab/salmon tximport v1.8.0 Soneson et al. 201571 https://bioconductor.org/packages/ release/bioc/html/tximport.html BraCeR Lindeman et al. 201872 https://github.com/Teichlab/bracer Scater McCarthy et al. 201773 https://bioconductor.org/packages/ release/bioc/html/scater.html Scanpy v1.9.1 Wolf et al. 201874 https://scanpy.readthedocs.io/en/stable/ NaiveDE v1.2.0 N/A https://github.com/Teichlab/NaiveDE scikit-learn v1.0.2 Pedregosa et al. 201175 https://scikit-learn.org/stable/ EnhancedVolcano v1.18.0 N/A https://github.com/kevinblighe/ EnhancedVolcano (Continued on next page) Cell Reports 43, 114045, April 23, 2024 17
Single Cell:Article Title: Generation of circulating autoreactive pre-plasma cells fueled by naive B cells in celiac disease.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Antibodies used for flow cytometry (Table S2) See Table S2 See Table S2 Goat anti-human Ig SouthernBiotech Cat# 2010-01; RRID:AB_2687525 AP-goat anti-human IgM SouthernBiotech Cat# 2020-04; RRID:AB_2795602 AP-goat anti-human IgA Sigma Cat# A9669; RRID:AB_258467 AP-goat anti-human IgG SouthernBiotech Cat# 2040-04; RRID:AB_2795643 Mouse anti-human IL-21 Thermo Cat# 14-7219-81; RRID:AB_1311262 Biotin-mouse anti-human IL-21 Thermo Cat# 13-7218-81; RRID:AB_1272318 Barcoded mouse anti-human CD27, TotalSeq-C0154 BioLegend Cat# 302853; RRID:AB_2800747 Barcoded mouse anti-human hashtag 1, TotalSeq-C0251 BioLegend Cat# 394661; RRID:AB_2801031 Barcoded mouse anti-human hashtag 2, TotalSeq-C0252 BioLegend Cat# 394663; RRID:AB_2801032 Biological samples Blood samples of CeD patients and controls This paper N/A Duodenal biopsies of CeD patients and controls This paper N/A Chemicals, peptides, and recombinant proteins Streptavidin-AP SouthernBiotech Cat# 7105-04 Streptavidin-PE Thermo Cat# S866 Streptavidin-PE/Cy7 Thermo Cat# SA1012 Barcoded streptavidin-PE, TotalSeq-C0951 BioLegend Cat# 405261 FcR Blocking Reagent Miltenyi Cat# 130-059-901 LIVE/DEAD fixable Aqua Thermo Cat# L34957 Lipofectin Thermo Cat# 18292011 Retinoic acid Sigma Cat# R2625 Recombinant human IL-21 R&D Systems Cat# 8879-IL-010 Biotin-TG2 This paper N/A Biotin-GST This paper N/A Recombinant anti-TG2 mAbs Iversen et al. 201565 N/A Tn5 transposase University of Oslo N/A Critical commercial assays BirA biotin-protein ligase reaction kit Avidity Cat# Bulk BirA Anti-PE microbeads Miltenyi Cat# 130-048-801 B cell isolation kit II Miltenyi Cat# 130-091-151 MS columns Miltenyi Cat# 130-042-201 LS columns Miltenyi Cat# 130-042-401 FoxP3/Transcription Factor Staining Buffer Set Thermo Cat# 00-5523-00 MultiScreen plates Sigma Cat# MSIPS4510 RNAClean XP beads Beckman Coulter Cat# A63987 AMPure XP beads Beckman Coulter Cat# A63881 SMARTScribe Reverse Transcriptase Takara Cat# 639538 Chromium Single Cell 50 Library & Gel Bead Kit 10x Genomics Cat# 1000014 Chromium Single Cell 50 Library Construction Kit 10x Genomics Cat# 1000020 Chromium Chip A Single Cell Kit 10x Genomics Cat# 1000009 Chromium i7 Multiplex Kit 10x Genomics Cat# 120262 Chromium i7 Multiplex Kit N, Set A 10x Genomics Cat# 1000084 (Continued on next page) 16 Cell Reports 43, 114045, April 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Chromium Single Cell 50 Feature Barcode Library Kit 10x Genomics Cat# 1000080 Chromium Single Cell V(D)J Enrichment Kit, Human B cells 10x Genomics Cat# 1000016 Deposited data scRNA-seq and V(D)J sequences of circulating B cells This study European Genome-Phenome Archive: EGAS50000000229 scRNA-seq and V(D)J sequences of gut plasma cells This study European Genome-Phenome Archive: EGAS50000000229 V(D)J sequences of single B cell cultures This study European Genome-Phenome Archive: EGAS50000000229 V(D)J sequences of gut plasma cells Lindeman et al. 20213 European Genome-Phenome Archive: EGAS00001004623 Experimental models: Cell lines Transfected NIH/3T3 fibroblasts (clone 2B09) This paper N/A Oligonucleotides IgA primers Zhou et al. 202266 N/A Smart-seq2 primers Picelli et al. 201421 N/A Nextera (XT) N7xx and S5xx index primers Biomers N/A 50-Bio-TSO Qiagen N/A Recombinant DNA AviTag-TG2 in pET28a Hnida et al. 201667 N/A AviTag-GST in pET28a This study N/A Human BAFF in pUNO1 InvivoGen Cat# puno1-htnfsf13b Human CD40L in pUNO1 InvivoGen Cat# puno1-hcd40lg Human IL-21 in pUNO1 InvivoGen Cat# puno1-hil21 Human IL-21 in pcDNA3 This study N/A Software and algorithms FlowJo v10 BD https://www.flowjo.com/ GraphPad Prism v9 Dotmatrics https://www.graphpad.com/ R v3.5.3 and v.4.3.1 The R Foundation https://www.r-project.org ggpubr v0.6.0 N/A https://cran.r-project.org/web/ packages/ggpubr/index.html Python v.3.7 Python Software Foundation https://www.python.org Cell Ranger v6.0.2 10x Genomics https://www.10xgenomics.com/ support/software/cell-ranger/latest Seurat v4.3.0.1 Hao et al. 202168 https://satijalab.org/seurat/ Cutadapt v1.18 Martin 201169 https://cutadapt.readthedocs.io/ en/stable/ Trim Galore v0.6.1 N/A https://www.bioinformatics.babraham. ac.uk/projects/trim_galore/ Salmon v0.11.3 Patro et al. 201770 https://github.com/COMBINE-lab/salmon tximport v1.8.0 Soneson et al. 201571 https://bioconductor.org/packages/ release/bioc/html/tximport.html BraCeR Lindeman et al. 201872 https://github.com/Teichlab/bracer Scater McCarthy et al. 201773 https://bioconductor.org/packages/ release/bioc/html/scater.html Scanpy v1.9.1 Wolf et al. 201874 https://scanpy.readthedocs.io/en/stable/ NaiveDE v1.2.0 N/A https://github.com/Teichlab/NaiveDE scikit-learn v1.0.2 Pedregosa et al. 201175 https://scikit-learn.org/stable/ EnhancedVolcano v1.18.0 N/A https://github.com/kevinblighe/ EnhancedVolcano (Continued on next page) Cell Reports 43, 114045, April 23, 2024 17
Multiplex Assay:Article Title: Generation of circulating autoreactive pre-plasma cells fueled by naive B cells in celiac disease.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Antibodies used for flow cytometry (Table S2) See Table S2 See Table S2 Goat anti-human Ig SouthernBiotech Cat# 2010-01; RRID:AB_2687525 AP-goat anti-human IgM SouthernBiotech Cat# 2020-04; RRID:AB_2795602 AP-goat anti-human IgA Sigma Cat# A9669; RRID:AB_258467 AP-goat anti-human IgG SouthernBiotech Cat# 2040-04; RRID:AB_2795643 Mouse anti-human IL-21 Thermo Cat# 14-7219-81; RRID:AB_1311262 Biotin-mouse anti-human IL-21 Thermo Cat# 13-7218-81; RRID:AB_1272318 Barcoded mouse anti-human CD27, TotalSeq-C0154 BioLegend Cat# 302853; RRID:AB_2800747 Barcoded mouse anti-human hashtag 1, TotalSeq-C0251 BioLegend Cat# 394661; RRID:AB_2801031 Barcoded mouse anti-human hashtag 2, TotalSeq-C0252 BioLegend Cat# 394663; RRID:AB_2801032 Biological samples Blood samples of CeD patients and controls This paper N/A Duodenal biopsies of CeD patients and controls This paper N/A Chemicals, peptides, and recombinant proteins Streptavidin-AP SouthernBiotech Cat# 7105-04 Streptavidin-PE Thermo Cat# S866 Streptavidin-PE/Cy7 Thermo Cat# SA1012 Barcoded streptavidin-PE, TotalSeq-C0951 BioLegend Cat# 405261 FcR Blocking Reagent Miltenyi Cat# 130-059-901 LIVE/DEAD fixable Aqua Thermo Cat# L34957 Lipofectin Thermo Cat# 18292011 Retinoic acid Sigma Cat# R2625 Recombinant human IL-21 R&D Systems Cat# 8879-IL-010 Biotin-TG2 This paper N/A Biotin-GST This paper N/A Recombinant anti-TG2 mAbs Iversen et al. 201565 N/A Tn5 transposase University of Oslo N/A Critical commercial assays BirA biotin-protein ligase reaction kit Avidity Cat# Bulk BirA Anti-PE microbeads Miltenyi Cat# 130-048-801 B cell isolation kit II Miltenyi Cat# 130-091-151 MS columns Miltenyi Cat# 130-042-201 LS columns Miltenyi Cat# 130-042-401 FoxP3/Transcription Factor Staining Buffer Set Thermo Cat# 00-5523-00 MultiScreen plates Sigma Cat# MSIPS4510 RNAClean XP beads Beckman Coulter Cat# A63987 AMPure XP beads Beckman Coulter Cat# A63881 SMARTScribe Reverse Transcriptase Takara Cat# 639538 Chromium Single Cell 50 Library & Gel Bead Kit 10x Genomics Cat# 1000014 Chromium Single Cell 50 Library Construction Kit 10x Genomics Cat# 1000020 Chromium Chip A Single Cell Kit 10x Genomics Cat# 1000009 Chromium i7 Multiplex Kit 10x Genomics Cat# 120262 Chromium i7 Multiplex Kit N, Set A 10x Genomics Cat# 1000084 (Continued on next page) 16 Cell Reports 43, 114045, April 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Chromium Single Cell 50 Feature Barcode Library Kit 10x Genomics Cat# 1000080 Chromium Single Cell V(D)J Enrichment Kit, Human B cells 10x Genomics Cat# 1000016 Deposited data scRNA-seq and V(D)J sequences of circulating B cells This study European Genome-Phenome Archive: EGAS50000000229 scRNA-seq and V(D)J sequences of gut plasma cells This study European Genome-Phenome Archive: EGAS50000000229 V(D)J sequences of single B cell cultures This study European Genome-Phenome Archive: EGAS50000000229 V(D)J sequences of gut plasma cells Lindeman et al. 20213 European Genome-Phenome Archive: EGAS00001004623 Experimental models: Cell lines Transfected NIH/3T3 fibroblasts (clone 2B09) This paper N/A Oligonucleotides IgA primers Zhou et al. 202266 N/A Smart-seq2 primers Picelli et al. 201421 N/A Nextera (XT) N7xx and S5xx index primers Biomers N/A 50-Bio-TSO Qiagen N/A Recombinant DNA AviTag-TG2 in pET28a Hnida et al. 201667 N/A AviTag-GST in pET28a This study N/A Human BAFF in pUNO1 InvivoGen Cat# puno1-htnfsf13b Human CD40L in pUNO1 InvivoGen Cat# puno1-hcd40lg Human IL-21 in pUNO1 InvivoGen Cat# puno1-hil21 Human IL-21 in pcDNA3 This study N/A Software and algorithms FlowJo v10 BD https://www.flowjo.com/ GraphPad Prism v9 Dotmatrics https://www.graphpad.com/ R v3.5.3 and v.4.3.1 The R Foundation https://www.r-project.org ggpubr v0.6.0 N/A https://cran.r-project.org/web/ packages/ggpubr/index.html Python v.3.7 Python Software Foundation https://www.python.org Cell Ranger v6.0.2 10x Genomics https://www.10xgenomics.com/ support/software/cell-ranger/latest Seurat v4.3.0.1 Hao et al. 202168 https://satijalab.org/seurat/ Cutadapt v1.18 Martin 201169 https://cutadapt.readthedocs.io/ en/stable/ Trim Galore v0.6.1 N/A https://www.bioinformatics.babraham. ac.uk/projects/trim_galore/ Salmon v0.11.3 Patro et al. 201770 https://github.com/COMBINE-lab/salmon tximport v1.8.0 Soneson et al. 201571 https://bioconductor.org/packages/ release/bioc/html/tximport.html BraCeR Lindeman et al. 201872 https://github.com/Teichlab/bracer Scater McCarthy et al. 201773 https://bioconductor.org/packages/ release/bioc/html/scater.html Scanpy v1.9.1 Wolf et al. 201874 https://scanpy.readthedocs.io/en/stable/ NaiveDE v1.2.0 N/A https://github.com/Teichlab/NaiveDE scikit-learn v1.0.2 Pedregosa et al. 201175 https://scikit-learn.org/stable/ EnhancedVolcano v1.18.0 N/A https://github.com/kevinblighe/ EnhancedVolcano (Continued on next page) Cell Reports 43, 114045, April 23, 2024 17
other:Article Title: Hepatocyte PLAGL2 deficiency alleviates MASH through MYD88-licensed inactivation of inflammasome.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Caspase 3/p17/p19 Rabbit Polyclonal antibody Proteintech Cat#19677-1-AP; RRID: AB_10733244 Caspase 9/P35/P10 Polyclonal antibody Proteintech Cat#10380-1-AP; RRID:AB_2068632 BAX Polyclonal antibody Proteintech Cat#50599-2-Ig; RRID: AB_2061561 Bcl2 Monoclonal antibody Proteintech Cat#68103-1-Ig; RRID: AB_2923635 Phospho-MLKL(Ser358)(D6H3V) Rabbit mAb CST Cat#91689; RRID: AB_2732034 MLKL Monoclonal antibody Proteintech Cat#66675-1-Ig; RRID: AB_2882029 Phospho-RIP3 (Ser227)(D6W2T)Rabbit mAb CST Cat#93654; RRID: AB_2800206 RIP3 Polyclonal antibody Proteintech Cat#17563-1-AP; RRID: AB_2178659 Phospho-RIP3 (Thr231/Ser232) (E7S1R) Rabbit mAb CST Cat#91702; RRID: AB_2937060 Albumin Polyclonal antibody Proteintech Cat#16475-1-AP; RRID: AB_2242567 CD45 Polyclonal antibody Proteintech Cat#20103-1-AP; RRID:AB_2716813 RIPK1-Specific Polyclonal antibody Proteintech Cat#17519-1-AP; RRID: AB_10642833 Normal Rabbit IgG Antibody CST Cat#2729; RRID: AB_1031062 Bacterial and virus strains LV16-PLAGL2-homo-455 GenePharma GCTTCCAAATACAAGCTGTAT LV2N-MYD88-homo-577 GenePharma CCGGCAACTGGAACAGACAAA LV2N-MYD88-homo-744 GenePharma TCCAGACCAAATTTGCACTCA LV2N-NC-homo GenePharma TTCTCCGAACGTGTCACGT Biological samples Monkey liver tissue sections Institute of Model Animal Wuhan University N/A Chemicals, peptides, and recombinant proteins RBC Lysis Buffer (10x) Biolegend Cat#420301 FcR Blocking Reagent Miltenyi Cat#130-092-575 Percoll cytiva Cat#10312604 Recombinant Murine IL-1β PeproTech Cat#211-11B DN25 Sigma Cat#9003-98-9 Collagenase D Roche Cat#3.4.24.3 Protease inhibitor (100x) Fdbio Cat#FD1001 Phosphatase inhibitor (100x) Fdbio Cat#FD1002 JetPRIME Transfection reagent Polyplus Cat#114-15 MCSF PeproTech Cat#315-02 LPS Sigma Cat#L6529 RNA iso Plus Takara Cat#9019 ChamQ SYBR qPCR Master Mix (Low ROX Premixed) Vazyme Cat#Q331 HiScript III RT SuperMix for qPCR (+gDNA wiper) Vazyme Cat#R323 Palmitic acid Sigma Cat#P0500 Diacerein MCE Cat#HY-N0283 Oil Red O Sigma Cat#O9755 ITS-G Thermo Fisher Cat#41400045 Dexamethasone Solarbio Cat#ID0170 Bovine Serum Albumin V (Fatty acid free) Solarbio Cat#A8850 Collagenase Sigma Cat#C0130 EGTA Sigma Cat#E0396 Cell lysis buffer for Western and IP without inhibitors Beyotime Cat#P0013J Protease inhibitors Fdbio Cat#FD1001 Phosphatase inhibitors Fdbio Cat#FD1002 Tissue Tec O.C.T.
|
Miltenyi Biotec is a verified supplier 
Miltenyi Biotec manufactures this product 